Sophia Sektor Cryptocurrency Dog - Mix of Labrador, Border Collie, Rottweiler, Pitbull terrier, Corgi, Husky and St. Bernard
Sophia Sektor
  • Purity 13%
  • Age 17 months
  • Racing Exp 20
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 10 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

Here in cyberspace, I ain't got much use for a floppy disc. I love connecting with my friends via pee-mail. Hound Dog by Elvis is probably the best song ever written. I don't like running outta pee when there are still so many trees. I'm willing to try little bondage, so my human chained me up!

Racing Stats

Ran 10 races
  • 0 0 2
 Best Time16.08 sec
Rank 80  RacingĀ *** Pts
20.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTCCCCACCACCATACCACCACAGCACATGA
T
A
C
T
C
C
C
C
A
C
C
A
C
C
A
T
A
C
C
A
C
C
A
C
A
G
C
A
C
A
T
G
A
Genes: JN555JHHO4B

Composition

Labrador
27%
Border Collie
18%
Rottweiler
18%
Pitbull terrier
9%
Corgi
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -15 points
Lunar Effect -6 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Border Collie
Snout Rottweiler
Mouth Rottweiler
Nose Corgi
Eyes Husky
Color St. Bernard