Sophia Sektor Cryptocurrency Dog - Mix of Labrador, Border Collie, Rottweiler, Pitbull terrier, Corgi, Husky and St. Bernard

Achievements

Racer
Sophia Sektor
Here in cyberspace, I ain't got much use for a floppy disc. I love connecting with my friends via pee-mail. Hound Dog by Elvis is probably the best song ever written. I don't like running outta pee when there are still so many trees. I'm willing to try little bondage, so my human chained me up!
  • Purity 13%
  • Age 20 months
  • Racing Exp 8
  • Labrador 27%
  • 3 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time16.08 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCCCCACCACCATACCACCACAGCACATGA
T
A
C
T
C
C
C
C
A
C
C
A
C
C
A
T
A
C
C
A
C
C
A
C
A
G
C
A
C
A
T
G
A
Genes: JN555JHHO4B

Composition

Labrador
27%
Border Collie
18%
Rottweiler
18%
Pitbull terrier
9%
Corgi
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -15 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Border Collie
Snout Rottweiler
Mouth Rottweiler
Nose Corgi
Eyes Husky
Color St. Bernard