Mac Mollie Virtual Crypto Game Dog - Mix of Border Collie, German Shepard, Rottweiler, Pitbull terrier, Yorkshire Terrier, Labrador BK, Husky and Shiba Inu
Mac Mollie
  • Purity 6%
  • Age 13 months
  • Racing Exp 1
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Nyan Cat is my best friend here in the cyberspace. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? My favorite place to sleep is under the covers between my humans. I never met a leg I didn't want to hump.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.00 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTCCTTAGCATCATACCACCACTCAACAGTA
T
A
C
T
C
C
T
T
A
G
C
A
T
C
A
T
A
C
C
A
C
C
A
C
T
C
A
A
C
A
G
T
A
Genes: JNF67JHH74E

Composition

Border Collie
18%
German Shepard
18%
Rottweiler
18%
Pitbull terrier
9%
Yorkshire Terrier
9%
Labrador BK
9%
Husky
9%
Shiba Inu
9%

Current Energy

Vitality -15 points
Lunar Effect +14 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Yorkshire Terrier
Front Legs Labrador BK
Head German Shepard
Ears Border Collie
Snout Rottweiler
Mouth Rottweiler
Nose German Shepard
Eyes Husky
Color Shiba Inu