Birdo Bullseye Bitcoin Dog - Mix of Border Collie, Shiba Inu, Yorkshire Terrier, Labrador, Rottweiler, Pug and Husky
Birdo Bullseye
  • Purity 12%
  • Age 13 months
  • Racing Exp 15
  • Border Collie 36%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

You can call me Birdo Bullseye, everybody else does. I live in cyberspace where you can turn me on. You know the worst? Watching my humans 'get it on' and I have to lick myself. I love connecting with my friends via pee-mail. If I can't reach it to clean it myself, it doesn't need cleaning!

Racing Stats

Ran 3 races
  • 1 0 1
 Best Time15.38 sec
Rank 40  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTACTTATACCCATACCACGAAGTAACAGTA
T
A
C
T
A
C
T
T
A
T
A
C
C
C
A
T
A
C
C
A
C
G
A
A
G
T
A
A
C
A
G
T
A
Genes: JJFJ5JH2E4E

Composition

Border Collie
36%
Shiba Inu
18%
Yorkshire Terrier
9%
Labrador
9%
Rottweiler
9%
Pug
9%
Husky
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Yorkshire Terrier
Front Legs Border Collie
Head Labrador
Ears Border Collie
Snout Rottweiler
Mouth Pug
Nose Shiba Inu
Eyes Husky
Color Shiba Inu

Parents

No Children

Photos

cryptocurrency dog racing crypto pet racing podium
Gift