Sideline Stitch Bitcoin Game Dog - Mix of Border Collie, Shiba Inu, Beagle, Dachshund, Labrador, Corgi, Schnauzer, Pug and Grey Wolf
Sideline Stitch
  • Purity 3%
  • Age 37 months
  • Racing Exp 71
  • Border Collie 18%
  • Gold medal 2 Silver medal 1 Bronze medal 6
  • 21 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

If you'd like to get together, I'm Sideline Stitch. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 21 races
  • 2 1 6
 Best Time15.35 sec
No rank  RacingĀ *** Pts
42.9 % wins (9) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTATACGGATACCCAAGCATAGAAGTACCCGTA
C
T
A
T
A
C
G
G
A
T
A
C
C
C
A
A
G
C
A
T
A
G
A
A
G
T
A
C
C
C
G
T
A
Genes: DJAJ5OC2ELE

Composition

Border Collie
18%
Shiba Inu
18%
Beagle
9%
Dachshund
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect -14 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Labrador
Ears Corgi
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Grey Wolf
Color Shiba Inu