Sideline Stitch Bitcoin Game Dog - Mix of Border Collie, Shiba Inu, Beagle, Dachshund, Labrador, Corgi, Schnauzer, Pug and Grey Wolf

Achievements

Podium Champion
Pro Racer
Sideline Stitch
If you'd like to get together, I'm Sideline Stitch. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm looking to share time together and not just to be an accessory.
  • Purity 3%
  • Age 40 months
  • Racing Exp 55
  • Border Collie 18%
  • 15 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 1 4
15 races    Best Time15.35 sec
No rank  Racing *** Coins
46.7 % wins (7) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACGGATACCCAAGCATAGAAGTACCCGTA
C
T
A
T
A
C
G
G
A
T
A
C
C
C
A
A
G
C
A
T
A
G
A
A
G
T
A
C
C
C
G
T
A
Genes: DJAJ5OC2ELE

Composition

Border Collie
18%
Shiba Inu
18%
Beagle
9%
Dachshund
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Labrador
Ears Corgi
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Grey Wolf
Color Shiba Inu