Hulk Hallie Litecoin Game Dog - Mix of Border Collie, Labrador, Dachshund, Husky, Labrador BK, Grey Wolf and Rottweiler

Achievements

None
Hulk Hallie
Slipping my collar, running off and making my humans worried? Every chance I get. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 14%
  • Age 40 months
  • Racing Exp 0
  • Border Collie 36%
  • 0 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACGGATACCCACCAACATACGCACCCCAC
T
A
C
T
A
C
G
G
A
T
A
C
C
C
A
C
C
A
A
C
A
T
A
C
G
C
A
C
C
C
C
A
C
Genes: JJAJ554J6LH

Composition

Border Collie
36%
Labrador
18%
Dachshund
9%
Husky
9%
Labrador BK
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -34 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Labrador
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes Grey Wolf
Color Rottweiler