Doogie Diego Crypto Game Dog - Mix of Border Collie, German Shepard, Shiba Inu, Labrador, Husky, Labrador BK and Rottweiler

Achievements

None
Doogie Diego
Hey, Baby. I'm Doogie Diego. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I enjoy mixing it up once in a while by visiting different dog parks. When my human brushes my coat, I get frisky! I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.
  • Purity 9%
  • Age 42 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 6
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCAGTATACTCACCAACATACGCATCACAC
T
A
C
T
C
A
G
T
A
T
A
C
T
C
A
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
C
A
C
Genes: J7EJ754J67H

Composition

Border Collie
27%
German Shepard
27%
Shiba Inu
9%
Labrador
9%
Husky
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -25 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Shiba Inu
Front Legs Border Collie
Head German Shepard
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Rottweiler