Lacy Lou Crypto Dog - Mix of Border Collie, Maltese, Husky, Labrador, Labrador BK, German Shepard and Rottweiler

Achievements

None
Lacy Lou
I'm Lacy Lou and I'd like to show you a trick or two. I run on the information superhighway and haven't been hit by a car yet. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!!
  • Purity 7%
  • Age 41 months
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACACCACATACACCCCAACATACGCATCACAC
T
A
C
A
C
C
A
C
A
T
A
C
A
C
C
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
C
A
C
Genes: JK4JK54J67H

Composition

Border Collie
27%
Maltese
18%
Husky
18%
Labrador
9%
Labrador BK
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -27 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Husky
Front Legs Border Collie
Head Maltese
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Rottweiler