Zelda Zane Litecoin Dog - Mix of Border Collie, Labrador, Maltese, Dachshund, Pitbull terrier, Labrador BK, Pug and Corgi

Achievements

Racer
Zelda Zane
I'm Zelda Zane and I'd like to show you a trick or two. I like never worrying about my dog poo. I've got people for that. I cry whenever I hear an ambulance siren! You know the worst? Watching my humans 'get it on' and I have to lick myself. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy!
  • Purity 8%
  • Age 41 months
  • Racing Exp 24
  • Border Collie 27%
  • 5 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 2 0
5 races    Best Time15.13 sec
No rank  Racing *** Coins
60.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACACCGGATACTCCCCACCATACGCAGAAAGC
T
A
C
A
C
C
G
G
A
T
A
C
T
C
C
C
C
A
C
C
A
T
A
C
G
C
A
G
A
A
A
G
C
Genes: JKAJN55J62O

Composition

Border Collie
27%
Labrador
18%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
Labrador BK
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Dachshund
Front Legs Border Collie
Head Pitbull terrier
Ears Labrador
Snout Labrador
Mouth Border Collie
Nose Labrador BK
Eyes Pug
Color Corgi