Gordo Grommit Litecoin Dog - Mix of Border Collie, Maltese, Dachshund, Pitbull terrier, Pug and Corgi

Achievements

Racer
Gordo Grommit
Greetings. My name is Gordo Grommit. I am a proud show dog. I like showing off my perfect coat! Watching kids play without me is the worst, no? I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 27%
  • Age 20 months
  • Racing Exp 10
  • Border Collie 55%
  • 4 races
  • Gen 6
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
4 races    Best Time16.33 sec
No rank  Racing *** Coins
25.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACACCGGATACTCCTACTACTACTACGAAAGC
T
A
C
A
C
C
G
G
A
T
A
C
T
C
C
T
A
C
T
A
C
T
A
C
T
A
C
G
A
A
A
G
C
Genes: JKAJNJJJJ2O

Composition

Border Collie
55%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Dachshund
Front Legs Border Collie
Head Pitbull terrier
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Pug
Color Corgi