Gordo Grommit Litecoin Dog - Mix of Border Collie, Maltese, Dachshund, Pitbull terrier, Pug and Corgi
Gordo Grommit
  • Purity 27%
  • Age 13 months
  • Racing Exp 10
  • Border Collie 55%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

Greetings. My name is Gordo Grommit. I am a proud show dog. I like showing off my perfect coat! Watching kids play without me is the worst, no? I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).

Racing Stats

Ran 4 races
  • 0 1 0
 Best Time16.33 sec
No rank  RacingĀ *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACACCGGATACTCCTACTACTACTACGAAAGC
T
A
C
A
C
C
G
G
A
T
A
C
T
C
C
T
A
C
T
A
C
T
A
C
T
A
C
G
A
A
A
G
C
Genes: JKAJNJJJJ2O

Composition

Border Collie
55%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect +14 points

Traits Breakdown

Body Border Collie
Tail Maltese
Legs Dachshund
Front Legs Border Collie
Head Pitbull terrier
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Pug
Color Corgi

Parents

No Children

Photos

Litecoin dog race
Gift