Snowflake Scruffy Crypto Dog - Pure Border Collie

Achievements

First Pure Breed Dog
Racer
Podium Champion
Snowflake Scruffy
Suh? How's it goin? I'm Snowflake Scruffy. Those flying monkeys in the Wizard of Oz still scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 100%
  • Age 40 months
  • Racing Exp 33
  • Border Collie 100%
  • 8 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 1 1
8 races    Best Time15.37 sec
Rank 71  Racing *** Coins
50.0 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
Genes: JJJJJJJJJJJ

Composition

Border Collie
100%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred Border Collie