Snowflake Scruffy Crypto Dog - Pure Border Collie
Snowflake Scruffy
  • Purity 100%
  • Age 33 months
  • Racing Exp 16
  • Border Collie 100%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

First Pure Breed Dog
Racer

Bio

Suh? How's it goin? I'm Snowflake Scruffy. Those flying monkeys in the Wizard of Oz still scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! You know the worst? Watching my humans 'get it on' when I've got no one.

Racing Stats

Ran 3 races
  • 1 1 0
 Best Time15.37 sec
Rank 37  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
Genes: JJJJJJJJJJJ

Composition

Border Collie
100%

Current Energy

Vitality -2 points
Lunar Effect +24 points

Traits Breakdown

Traits 100% Purebred Border Collie