Ash Athena Bitcoin Dog - Pure Border Collie
Ash Athena
  • Purity 100%
  • Age 13 months
  • Racing Exp 13
  • Border Collie 100%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 3 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. Watching kids play without me is the worst, no? I've been looking for love in all the wrong places... As a perfectionist, I have to find just the right 'spot'. I'm just looking for some puppy love.

Racing Stats

Ran 3 races
  • 0 0 2
 Best Time15.73 sec
Rank 84  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACTAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
Genes: JJJJJJJJJJJ

Composition

Border Collie
100%

Current Energy

Vitality -2 points
Lunar Effect +24 points

Traits Breakdown

Traits 100% Purebred Border Collie

Parents

No Children

Photos

Litecoin dog racing photo online canine racing photo
Gift