Alice Al Bundy Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Poodle, Dachshund, Labrador BK, Yorkshire Terrier, Corgi, Pug, Schnauzer and Golder Retriever
Alice Al Bundy
  • Purity 1%
  • Age 17 months
  • Racing Exp 49
  • Grey Wolf 18%
  • Gold medal 1 Silver medal 3 Bronze medal 3
  • 9 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Even living on the internet like I do, too much kibble makes my bandwidth expand. I'm not a fan of sleeping on the floor. This body was made for cuddles! What's your favorite bed? Mine is the dirty laundry. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 9 races
  • 1 3 3
 Best Time15.95 sec
Rank 33  RacingĀ *** Pts
77.8 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCCTAGACGGAGCATTAAGCGAACCCATAAGA
C
C
C
C
T
A
G
A
C
G
G
A
G
C
A
T
T
A
A
G
C
G
A
A
C
C
C
A
T
A
A
G
A
Genes: LDIA6FO2LC8

Composition

Grey Wolf
18%
Beagle
9%
Poodle
9%
Dachshund
9%
Labrador BK
9%
Yorkshire Terrier
9%
Corgi
9%
Pug
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality -35 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Poodle
Front Legs Dachshund
Head Labrador BK
Ears Yorkshire Terrier
Snout Corgi
Mouth Pug
Nose Grey Wolf
Eyes Schnauzer
Color Golder Retriever