Alice Al Bundy Cryptocurrency Dog - Mix of Grey Wolf, Beagle, Poodle, Dachshund, Labrador BK, Yorkshire Terrier, Corgi, Pug, Schnauzer and Golder Retriever
Alice Al Bundy
  • Purity 1%
  • Age 13 months
  • Racing Exp 14
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Even living on the internet like I do, too much kibble makes my bandwidth expand. I'm not a fan of sleeping on the floor. This body was made for cuddles! What's your favorite bed? Mine is the dirty laundry. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 2 races
  • 0 2 0
 Best Time16.07 sec
No rank  RacingĀ *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCCTAGACGGAGCATTAAGCGAACCCATAAGA
C
C
C
C
T
A
G
A
C
G
G
A
G
C
A
T
T
A
A
G
C
G
A
A
C
C
C
A
T
A
A
G
A
Genes: LDIA6FO2LC8

Composition

Grey Wolf
18%
Beagle
9%
Poodle
9%
Dachshund
9%
Labrador BK
9%
Yorkshire Terrier
9%
Corgi
9%
Pug
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality -35 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Poodle
Front Legs Dachshund
Head Labrador BK
Ears Yorkshire Terrier
Snout Corgi
Mouth Pug
Nose Grey Wolf
Eyes Schnauzer
Color Golder Retriever