Old Yeller Oracle Litecoin Dog - Mix of Labrador, Poodle, Shiba Inu, Beagle, Dachshund, Border Collie and Pitbull terrier

Achievements

Racer
Old Yeller Oracle
Good day to you! I'm Old Yeller Oracle! I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Hound Dog by Elvis is probably the best song ever written. I don't understand why I like smelling butts... I enjoy destroying a nice fresh pair of slippers.
  • Purity 11%
  • Age 20 months
  • Racing Exp 2
  • Labrador 27%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time14.98 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACTACCAGGATACGACGACCCAGTAGTATCC
C
C
A
C
T
A
C
C
A
G
G
A
T
A
C
G
A
C
G
A
C
C
C
A
G
T
A
G
T
A
T
C
C
Genes: 5D5AJII5EEN

Composition

Labrador
27%
Poodle
18%
Shiba Inu
18%
Beagle
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -6 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Labrador
Front Legs Dachshund
Head Border Collie
Ears Poodle
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Pitbull terrier