Old Yeller Oracle Litecoin Dog - Mix of Labrador, Poodle, Shiba Inu, Beagle, Dachshund, Border Collie and Pitbull terrier
Old Yeller Oracle
  • Purity 11%
  • Age 17 months
  • Racing Exp 22
  • Labrador 27%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 10 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Good day to you! I'm Old Yeller Oracle! I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Hound Dog by Elvis is probably the best song ever written. I don't understand why I like smelling butts... I enjoy destroying a nice fresh pair of slippers.

Racing Stats

Ran 10 races
  • 0 2 0
 Best Time14.98 sec
Rank 46  RacingĀ *** Pts
20.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCACTACCAGGATACGACGACCCAGTAGTATCC
C
C
A
C
T
A
C
C
A
G
G
A
T
A
C
G
A
C
G
A
C
C
C
A
G
T
A
G
T
A
T
C
C
Genes: 5D5AJII5EEN

Composition

Labrador
27%
Poodle
18%
Shiba Inu
18%
Beagle
9%
Dachshund
9%
Border Collie
9%
Pitbull terrier
9%

Current Energy

Vitality -6 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail Beagle
Legs Labrador
Front Legs Dachshund
Head Border Collie
Ears Poodle
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Pitbull terrier

Parents

No Children

Photos

crypto dog race photo virtual pet race
Gift