Jynx Johnny Cage Litecoin Dog - Mix of Pug, Border Collie and Labrador BK

Achievements

Racer
Jynx Johnny Cage
As a good digital dog, my humans give me virtually everything. I live life by my favorite quote "Every dog has it's day", but every day is my day! Oh, go ahead. Pet me. I know you want to. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 67%
  • Age 21 months
  • Racing Exp 15
  • Pug 82%
  • 3 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 2 0
3 races    Best Time16.23 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAATACGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J6222222

Composition

Pug
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -52 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

virtual dog race results crypto doggy race podium Litecoin canine racing online canine race results