Jynx Johnny Cage Litecoin Dog - Mix of Pug, Border Collie and Labrador BK
Jynx Johnny Cage
  • Purity 67%
  • Age 13 months
  • Racing Exp 15
  • Pug 82%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

As a good digital dog, my humans give me virtually everything. I live life by my favorite quote "Every dog has it's day", but every day is my day! Oh, go ahead. Pet me. I know you want to. I'm looking for a poodle in the streets, and a bulldog in the sheets!

Racing Stats

Ran 3 races
  • 0 2 0
 Best Time16.23 sec
No rank  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATACGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J6222222

Composition

Pug
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -52 points
Lunar Effect -20 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

virtual dog racing online canine racing
Gift