Theodora Trixie Crypto Dog - Mix of Pug, Border Collie and Corgi
Theodora Trixie
  • Purity 67%
  • Age 17 months
  • Racing Exp 24
  • Pug 82%
  • Gold medal 0 Silver medal 2 Bronze medal 1
  • 7 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Good day to you! I'm Theodora Trixie! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I enjoy mixing it up once in a while by visiting different dog parks. I've always wanted to be in commercials and be treated as the star I am!

Racing Stats

Ran 7 races
  • 0 2 1
 Best Time15.27 sec
No rank  RacingĀ *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATACAGCGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
A
G
C
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222JO222222

Composition

Pug
82%
Border Collie
9%
Corgi
9%

Current Energy

Vitality -52 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug