Theodora Trixie Crypto Dog - Mix of Pug, Border Collie and Corgi

Achievements

Racer
Theodora Trixie
Good day to you! I'm Theodora Trixie! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I enjoy mixing it up once in a while by visiting different dog parks. I've always wanted to be in commercials and be treated as the star I am!
  • Purity 67%
  • Age 22 months
  • Racing Exp 15
  • Pug 82%
  • 4 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
4 races    Best Time15.27 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAATACAGCGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
A
G
C
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222JO222222

Composition

Pug
82%
Border Collie
9%
Corgi
9%

Current Energy

Vitality -52 points
Lunar Effect -24 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug