Spud Samantha Bitcoin Dog - Mix of Pug, Border Collie and Labrador BK
Spud Samantha
  • Purity 67%
  • Age 14 months
  • Racing Exp 73
  • Pug 82%
  • Gold medal 3 Silver medal 3 Bronze medal 3
  • 19 races
  • Gen 3
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer

Bio

My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Forget plastic hotdogs...I'm into the classic chew toys like slippers. I have a crush on the Grumpy cat.

Racing Stats

Ran 19 races
  • 3 3 3
 Best Time15.40 sec
Rank 77  RacingĀ *** Pts
47.4 % wins (9) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATACGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J6222222

Composition

Pug
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -52 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug