Spud Samantha Bitcoin Dog - Mix of Pug, Border Collie and Labrador BK

Achievements

Racer
Podium Champion
Master Champion
Spud Samantha
My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Forget plastic hotdogs...I'm into the classic chew toys like slippers. I have a crush on the Grumpy cat.
  • Purity 67%
  • Age 19 months
  • Racing Exp 96
  • Pug 82%
  • 27 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

27 races   |
  • 3 3 6
 Best Time15.40 sec
No rank  Racing *** Pts
44.4 % wins (12) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATACGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J6222222

Composition

Pug
82%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -52 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug