Chessie Cupcake Bitcoin Dog - Mix of Pug, Shiba Inu, Yorkshire Terrier, Husky and Pitbull terrier
Chessie Cupcake
  • Purity 31%
  • Age 72 months
  • Racing Exp 90
  • Pug 55%
  • Gold medal 4 Silver medal 4 Bronze medal 2
  • 28 races
  • Gen 0
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

I'm into chasing fast cars, squirrels and my tail. I'll eat my vomit and yours too. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like going to the groomer. Leave my beautiful fur alone!

Racing Stats

Ran 28 races
  • 4 4 2
 Best Time15.30 sec
Rank 53  RacingĀ *** Pts
35.7% wins (10) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTATTAGAAGAAGAAGTAACATCC
G
A
A
G
A
A
G
A
A
G
T
A
T
T
A
G
A
A
G
A
A
G
A
A
G
T
A
A
C
A
T
C
C
Genes: 222EF222E4N

Composition

Pug
55%
Shiba Inu
18%
Yorkshire Terrier
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality -65 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Husky
Color Pitbull terrier