Chessie Cupcake Bitcoin Dog - Mix of Pug, Shiba Inu, Yorkshire Terrier, Husky and Pitbull terrier

Achievements

Racer
Podium Champion
Master Champion
Chessie Cupcake
I'm into chasing fast cars, squirrels and my tail. I'll eat my vomit and yours too. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I don't like going to the groomer. Leave my beautiful fur alone!
  • Purity 31%
  • Age 39 months
  • Racing Exp 115
  • Pug 55%
  • 38 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

38 races   |
  • 4 4 5
 Best Time15.30 sec
No rank  Racing *** Pts
34.2 % wins (13) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTATTAGAAGAAGAAGTAACATCC
G
A
A
G
A
A
G
A
A
G
T
A
T
T
A
G
A
A
G
A
A
G
A
A
G
T
A
A
C
A
T
C
C
Genes: 222EF222E4N

Composition

Pug
55%
Shiba Inu
18%
Yorkshire Terrier
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality -65 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Husky
Color Pitbull terrier