Bongo Benji Crypto Dog - Mix of Pug, Shiba Inu and Corgi
Bongo Benji
  • Purity 53%
  • Age 16 months
  • Racing Exp 41
  • Pug 73%
  • Gold medal 0 Silver medal 3 Bronze medal 1
  • 18 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Hello, there. Bongo Benji here. My turn-offs are rolled up newspapers and loud noises. My 'G' spot is under my chin...scratch me there and I'll growl softly. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. Little Bow Wow is my favorite musician. I just assume he's a dog...

Racing Stats

Ran 18 races
  • 0 3 1
 Best Time15.28 sec
No rank  RacingĀ *** Pts
22.2 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAGCGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
G
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EO222E22

Composition

Pug
73%
Shiba Inu
18%
Corgi
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug