Bongo Benji Crypto Dog - Mix of Pug, Shiba Inu and Corgi

Achievements

Racer
Podium Champion
Master Champion
Bongo Benji
Hello, there. Bongo Benji here. My turn-offs are rolled up newspapers and loud noises. My 'G' spot is under my chin...scratch me there and I'll growl softly. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. Little Bow Wow is my favorite musician. I just assume he's a dog...
  • Purity 53%
  • Age 19 months
  • Racing Exp 107
  • Pug 73%
  • 38 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

38 races   |
  • 1 7 4
 Best Time15.28 sec
No rank  Racing *** Pts
31.6 % wins (12) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAGCGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
G
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EO222E22

Composition

Pug
73%
Shiba Inu
18%
Corgi
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug