Yamaha Yardwork Bitcoin Dog - Mix of Pug, Shiba Inu, Corgi and German Shepard
Yamaha Yardwork
  • Purity 52%
  • Age 15 months
  • Racing Exp 8
  • Pug 73%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Well hello, beautiful. My name's Yamaha Yardwork. My humans say I bark too much, but I have a lot to say! Hope you like the smell of wet fur, because I'll jump into any water I see! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time15.78 sec
Rank 95  RacingĀ *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAGCGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
G
C
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 222EO222722

Composition

Pug
73%
Shiba Inu
9%
Corgi
9%
German Shepard
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug