Elektra Emo Litecoin Dog - Mix of Pug, Shiba Inu, Corgi and German Shepard
Elektra Emo
  • Purity 52%
  • Age 17 months
  • Racing Exp 20
  • Pug 73%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 15 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Yo dog! Elektra Emo here. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I never knew my father. Long or short hair works for me, just no baldies please. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 15 races
  • 0 0 1
 Best Time15.63 sec
No rank  RacingĀ *** Pts
6.7 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAGCGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
G
C
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 222EO222722

Composition

Pug
73%
Shiba Inu
9%
Corgi
9%
German Shepard
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug