Elektra Emo Litecoin Dog - Mix of Pug, Shiba Inu, Corgi and German Shepard

Achievements

Racer
Elektra Emo
Yo dog! Elektra Emo here. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I never knew my father. Long or short hair works for me, just no baldies please. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I want a mate that knows how to give a proper belly rub!
  • Purity 52%
  • Age 20 months
  • Racing Exp 4
  • Pug 73%
  • 4 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time16.03 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAGCGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
G
C
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 222EO222722

Composition

Pug
73%
Shiba Inu
9%
Corgi
9%
German Shepard
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Corgi
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug