Luigi Leia Litecoin Game Dog - Mix of Pug, Shiba Inu and Boxer

Achievements

Racer
Luigi Leia
As a perfectionist, I have to find just the right 'spot'. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I never met a crotch or a butt I didn't like, but I'm just friendly that way.
  • Purity 53%
  • Age 21 months
  • Racing Exp 8
  • Pug 73%
  • 3 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time15.87 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAACGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
A
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EG222E22

Composition

Pug
73%
Shiba Inu
18%
Boxer
9%

Current Energy

Vitality -64 points
Lunar Effect -12 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Boxer
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug