Luigi Leia Litecoin Game Dog - Mix of Pug, Shiba Inu and Boxer
Luigi Leia
  • Purity 53%
  • Age 17 months
  • Racing Exp 23
  • Pug 73%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 11 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

As a perfectionist, I have to find just the right 'spot'. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I never met a crotch or a butt I didn't like, but I'm just friendly that way.

Racing Stats

Ran 11 races
  • 1 0 1
 Best Time15.87 sec
No rank  RacingĀ *** Pts
18.2 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAAACGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
A
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EG222E22

Composition

Pug
73%
Shiba Inu
18%
Boxer
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Boxer
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug