Kibbles Kocoum Litecoin Dog - Mix of Pug, Shiba Inu and Border Collie

Achievements

Racer
Kibbles Kocoum
If you'd like to get together, I'm Kibbles Kocoum. I've been known to take mega bytes when playing ruff. I hate hiding under the bed during a thunder storm but that's just smart, right? It turns me on when I can show an older dog a new trick. I like exploring off leash best.
  • Purity 53%
  • Age 21 months
  • Racing Exp 10
  • Pug 73%
  • 3 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
3 races    Best Time16.00 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTATACGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
T
A
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EJ222E22

Composition

Pug
73%
Shiba Inu
18%
Border Collie
9%

Current Energy

Vitality -49 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Border Collie
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug