Kibbles Kocoum Litecoin Dog - Mix of Pug, Shiba Inu and Border Collie
Kibbles Kocoum
  • Purity 53%
  • Age 51 months
  • Racing Exp 33
  • Pug 73%
  • Gold medal 1 Silver medal 1 Bronze medal 2
  • 10 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

If you'd like to get together, I'm Kibbles Kocoum. I've been known to take mega bytes when playing ruff. I hate hiding under the bed during a thunder storm but that's just smart, right? It turns me on when I can show an older dog a new trick. I like exploring off leash best.

Racing Stats

Ran 10 races
  • 1 1 2
 Best Time16.00 sec
Rank 99  RacingĀ *** Pts
40.0% wins (4) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTATACGAAGAAGAAGTAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
T
A
C
G
A
A
G
A
A
G
A
A
G
T
A
G
A
A
G
A
A
Genes: 222EJ222E22

Composition

Pug
73%
Shiba Inu
18%
Border Collie
9%

Current Energy

Vitality -49 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Border Collie
Ears Pug
Snout Pug
Mouth Pug
Nose Shiba Inu
Eyes Pug
Color Pug