Audi Ava Bitcoin Dog - Mix of German Shepard, Pug and Beagle
Audi Ava
  • Purity 46%
  • Age 13 months
  • Racing Exp 11
  • German Shepard 64%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 5 races
  • Gen 15
Sad & Snaillike

Achievements

Racer

Bio

Once you go digital, baby, you never go back. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. Sometimes I just have to roll in something dead. I like to respond to sad puppy eyes with sad puppy eyes of my own. I hate it when other dogs pee in my yard! IT'S MY YARD!!

Racing Stats

Ran 5 races
  • 0 1 0
 Best Time16.32 sec
No rank  RacingĀ *** Pts
20.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAATCATCATCATCATCATCAGAACTATCAGAA
G
A
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
A
C
T
A
T
C
A
G
A
A
Genes: 27777772D72

Composition

German Shepard
64%
Pug
27%
Beagle
9%

Current Energy

Vitality -33 points
Lunar Effect -12 points

Traits Breakdown

Body Pug
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Pug
Nose Beagle
Eyes German Shepard
Color Pug