Baloo Body Bitcoin Dog - Mix of German Shepard, Rottweiler, Poodle, Beagle and Labrador BK
Baloo Body
  • Purity 40%
  • Age 15 months
  • Racing Exp 15
  • German Shepard 64%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 14
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

I live inside of a web app in a big data center. I'll eat my vomit and yours too. My favorite song is "Who Let the Dogs Out?" It was me :) I hate it when my human runs out of poop-bags. How embarrassing! My bark alone scares birds out of my yard.

Racing Stats

Ran 3 races
  • 1 0 1
 Best Time14.42 sec
Rank 4  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTCATCATCATCATCATCAGACCTATCAGCA
C
A
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
C
C
T
A
T
C
A
G
C
A
Genes: H777777ID76

Composition

German Shepard
64%
Rottweiler
9%
Poodle
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality -18 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Poodle
Nose Beagle
Eyes German Shepard
Color Labrador BK