Baloo Body Bitcoin Dog - Mix of German Shepard, Rottweiler, Poodle, Beagle and Labrador BK

Achievements

Racer
Baloo Body
I live inside of a web app in a big data center. I'll eat my vomit and yours too. My favorite song is "Who Let the Dogs Out?" It was me :) I hate it when my human runs out of poop-bags. How embarrassing! My bark alone scares birds out of my yard.
  • Purity 40%
  • Age 22 months
  • Racing Exp 15
  • German Shepard 64%
  • 3 races
  • Gen 14
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 1
 Best Time14.42 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTCATCATCATCATCATCAGACCTATCAGCA
C
A
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
C
C
T
A
T
C
A
G
C
A
Genes: H777777ID76

Composition

German Shepard
64%
Rottweiler
9%
Poodle
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality -18 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Poodle
Nose Beagle
Eyes German Shepard
Color Labrador BK