Georgia Govenor Crypto Game Dog - Mix of German Shepard, Maltese, Pug and Labrador BK

Achievements

Racer
Georgia Govenor
Let me introduce myself, I'm Georgia Govenor. I live in your digital dreams. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 41%
  • Age 21 months
  • Racing Exp 21
  • German Shepard 64%
  • 7 races
  • Gen 15
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 0
7 races    Best Time15.08 sec
No rank  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTCATCATCATCATCATCAGAAACCTCAGCA
A
C
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
A
A
C
C
T
C
A
G
C
A
Genes: K7777772K76

Composition

German Shepard
64%
Maltese
18%
Pug
9%
Labrador BK
9%

Current Energy

Vitality -33 points
Lunar Effect -20 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Pug
Nose Maltese
Eyes German Shepard
Color Labrador BK