Georgia Govenor Crypto Game Dog - Mix of German Shepard, Maltese, Pug and Labrador BK
Georgia Govenor
  • Purity 41%
  • Age 45 months
  • Racing Exp 28
  • German Shepard 64%
  • Gold medal 2 Silver medal 0 Bronze medal 0
  • 14 races
  • Gen 15
Depressed & Snaillike

Achievements

Racer

Bio

Let me introduce myself, I'm Georgia Govenor. I live in your digital dreams. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 14 races
  • 2 0 0
 Best Time15.08 sec
Rank 87  RacingĀ *** Pts
14.3% wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCTCATCATCATCATCATCAGAAACCTCAGCA
A
C
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
A
A
C
C
T
C
A
G
C
A
Genes: K7777772K76

Composition

German Shepard
64%
Maltese
18%
Pug
9%
Labrador BK
9%

Current Energy

Vitality -33 points
Lunar Effect +6 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Pug
Nose Maltese
Eyes German Shepard
Color Labrador BK

Parents

No Children

Photos

online canine racing results online dog race photo
Gift