Georgia Govenor Crypto Game Dog - Mix of German Shepard, Maltese, Pug and Labrador BK

Achievements

Racer
Podium Champion
Georgia Govenor
Let me introduce myself, I'm Georgia Govenor. I live in your digital dreams. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 41%
  • Age 18 months
  • Racing Exp 75
  • German Shepard 64%
  • 28 races
  • Gen 15
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

28 races   |
  • 3 1 4
 Best Time15.08 sec
Rank 92  Racing *** Pts
28.6 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTCATCATCATCATCATCAGAAACCTCAGCA
A
C
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
A
A
A
C
C
T
C
A
G
C
A
Genes: K7777772K76

Composition

German Shepard
64%
Maltese
18%
Pug
9%
Labrador BK
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Pug
Nose Maltese
Eyes German Shepard
Color Labrador BK