Kong Karma Litecoin Dog - Mix of Maltese, Pitbull terrier, Beagle, Boxer, Rottweiler, Schnauzer, Pug, German Shepard and Yorkshire Terrier
Kong Karma
  • Purity 5%
  • Age 36 months
  • Racing Exp 0
  • Maltese 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Suh...you good? Kong Karma here. I love a good book... I find them quite tasty. I don't understand why I like smelling butts... My favorite pastime is playing tug-of-war with my human's underwear. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCTCCTCCCTAAACCACATAGAAACCTCATTA
A
C
C
T
C
C
T
C
C
C
T
A
A
A
C
C
A
C
A
T
A
G
A
A
A
C
C
T
C
A
T
T
A
Genes: KNNDGHC2K7F

Composition

Maltese
18%
Pitbull terrier
18%
Beagle
9%
Boxer
9%
Rottweiler
9%
Schnauzer
9%
Pug
9%
German Shepard
9%
Yorkshire Terrier
9%

Current Energy

Vitality -65 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Beagle
Head Boxer
Ears Rottweiler
Snout Schnauzer
Mouth Pug
Nose Maltese
Eyes German Shepard
Color Yorkshire Terrier