Tidus Twinkie Digital Cryptocurrency Dog - Mix of German Shepard, Rottweiler, Schnauzer, Yorkshire Terrier, Golder Retriever, Husky, Poodle, Beagle, Corgi and Labrador BK

Achievements

Racer
Tidus Twinkie
I cry whenever I hear an ambulance siren! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... You know the worst? Watching my humans 'get it on' and I have to lick myself. If you are looking for companionship without commitment, keep looking.
  • Purity 1%
  • Age 20 months
  • Racing Exp 8
  • German Shepard 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time16.23 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACATATTATCAAGATCAACAGACCTAAGCGCA
C
A
C
A
T
A
T
T
A
T
C
A
A
G
A
T
C
A
A
C
A
G
A
C
C
T
A
A
G
C
G
C
A
Genes: HCF7874IDO6

Composition

German Shepard
18%
Rottweiler
9%
Schnauzer
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Husky
9%
Poodle
9%
Beagle
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality -41 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Schnauzer
Legs Yorkshire Terrier
Front Legs German Shepard
Head Golder Retriever
Ears German Shepard
Snout Husky
Mouth Poodle
Nose Beagle
Eyes Corgi
Color Labrador BK