Tinker Trouble Bitcoin Dog - Pure German Shepard

Achievements

Racer
Tinker Trouble
I live in cyberspace. I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. If I can't reach it to clean it myself, it doesn't need cleaning! I'm looking for someone to make bath time a little more bearable!
  • Purity 100%
  • Age 38 months
  • Racing Exp 15
  • German Shepard 100%
  • 5 races
  • Gen 13
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 0 0 2
 Best Time15.25 sec
Rank 99  Racing *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard