Dudley Daffy Bitcoin Dog - Pure German Shepard

Achievements

First Pure Breed Dog
Racer
Dudley Daffy
I live in your digital dreams. I'm the best at running circle 8's. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 100%
  • Age 42 months
  • Racing Exp 14
  • German Shepard 100%
  • 3 races
  • Gen 10
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 1
 Best Time15.50 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard