Sugar Snowball Bitcoin Dog - Mix of German Shepard, Corgi, Labrador BK, Pug and Dachshund

Achievements

Racer
Sugar Snowball
I'd like to take you for a byte to eat in cyberspace. Don't bother contacting me if you like cats. As a perfectionist, I have to find just the right 'spot'. I live life by my favorite quote "Every dog has it's day", but every day is my day! I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 24%
  • Age 3 months
  • Racing Exp 20
  • German Shepard 45%
  • 7 races
  • Gen 11
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 1 0
 Best Time15.82 sec
No rank  Racing *** Pts
28.6 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGAATCATCATCAAGCTCAGGAAGCAGCTCA
G
C
A
G
A
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
G
G
A
A
G
C
A
G
C
T
C
A
Genes: 62777O7AOO7

Composition

German Shepard
45%
Corgi
27%
Labrador BK
9%
Pug
9%
Dachshund
9%

Current Energy

Vitality 0 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color German Shepard