Jumbo Jelly Crypto Dog - Mix of German Shepard, Corgi and Dachshund

Achievements

Racer
Jumbo Jelly
My name is Jumbo Jelly and I'd really like to sniff you. I work in The Virtual Machine. I hate it when my humans fool me with a pill in peanut butter! I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 46%
  • Age 3 months
  • Racing Exp 18
  • German Shepard 64%
  • 6 races
  • Gen 14
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 1
 Best Time15.92 sec
No rank  Racing *** Pts
33.3 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCAAGCTCAGGAAGCAGCTCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
G
G
A
A
G
C
A
G
C
T
C
A
Genes: 77777O7AOO7

Composition

German Shepard
64%
Corgi
27%
Dachshund
9%

Current Energy

Vitality 0 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color German Shepard

Parents

No Children

Photos

crypto dog race results Litecoin canine race photo