Ref Rags Crypto Game Dog - Pure German Shepard

Achievements

Racer
Ref Rags
Who's a good dog? Hopefully you! Ref Rags here. I am a web of clouds kind of dog. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 100%
  • Age 38 months
  • Racing Exp 13
  • German Shepard 100%
  • 6 races
  • Gen 13
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 0
 Best Time15.07 sec
No rank  Racing *** Pts
16.7 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard