Rock Red Flag Litecoin Game Dog - Mix of German Shepard, Maltese and Border Collie

Achievements

Racer
Rock Red Flag
My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I've always had a crush on Lassie. My humans should try spending 8 hours a day in a crate! Forget plastic hotdogs...I'm into the classic chew toys like slippers. I just want to "share a bone"... ;)
  • Purity 65%
  • Age 41 months
  • Racing Exp 4
  • German Shepard 82%
  • 4 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time15.07 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACCTCATCATCATCATCATCATACTCATCA
T
C
A
A
C
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
A
C
T
C
A
T
C
A
Genes: 7K777777J77

Composition

German Shepard
82%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose Border Collie
Eyes German Shepard
Color German Shepard