Skywalker Santa Paws Cryptocurrency Dog - Mix of German Shepard, Border Collie, Maltese, Poodle, Grey Wolf and Yorkshire Terrier

Achievements

Racer
Skywalker Santa Paws
Whatcha know, honey. Skywalker Santa Paws here. As a digital dog, let me say Bob Dole did not invent the internet. Hound Dog by Elvis is probably the best song ever written. When I can break free, I enjoy exploring my neighborhood without my human. I want someone who can show me a good time; I'll do the same for you.
  • Purity 17%
  • Age 42 months
  • Racing Exp 15
  • German Shepard 36%
  • 2 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 1 0
 Best Time15.55 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACCTCAGACTACTCACCCTTATACTACTCA
T
C
A
A
C
C
T
C
A
G
A
C
T
A
C
T
C
A
C
C
C
T
T
A
T
A
C
T
A
C
T
C
A
Genes: 7K7IJ7LFJJ7

Composition

German Shepard
36%
Border Collie
27%
Maltese
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -9 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Maltese
Legs German Shepard
Front Legs Poodle
Head Border Collie
Ears German Shepard
Snout Grey Wolf
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Border Collie
Color German Shepard