Ulysses Ursula Crypto Game Dog - Pure German Shepard

Achievements

Podium Champion
Speed Champion
Pro Racer
Ulysses Ursula
I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! My favorite way to relax is to be scratched on my belly. Let me have a pig's ear and I'm in heaven. I've been known to run with bad dogs.
  • Purity 100%
  • Age 38 months
  • Racing Exp 71
  • German Shepard 100%
  • 24 races
  • Gen 11
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 3 1 4
 Best Time12.92 sec
No rank  Racing *** Pts
33.3 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard