Punky Petunia Litecoin Dog - Mix of German Shepard, Border Collie, Pug, Golder Retriever, Boxer, Husky and Corgi
Punky Petunia
  • Purity 16%
  • Age 13 months
  • Racing Exp 1
  • German Shepard 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Oh, go ahead. Pet me. I know you want to. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I like giving wet kisses. I don't understand why my human tries to give me tap water. I expect filtered and distilled!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.30 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTCAGAAAGATCATCAAACTCAACAAGCTCA
T
A
C
T
C
A
G
A
A
A
G
A
T
C
A
T
C
A
A
A
C
T
C
A
A
C
A
A
G
C
T
C
A
Genes: J72877G74O7

Composition

German Shepard
45%
Border Collie
9%
Pug
9%
Golder Retriever
9%
Boxer
9%
Husky
9%
Corgi
9%

Current Energy

Vitality -40 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Pug
Front Legs Golder Retriever
Head German Shepard
Ears German Shepard
Snout Boxer
Mouth German Shepard
Nose Husky
Eyes Corgi
Color German Shepard

Parents

No Children

Photos

Gift