Mojo Miles Bitcoin Game Dog - Mix of German Shepard, Boxer, Border Collie, Pug, Golder Retriever, Pitbull terrier, Husky, Corgi and Schnauzer
Mojo Miles
  • Purity 3%
  • Age 13 months
  • Racing Exp 1
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I was born in the web cloud. Size doesn't matter, I like 'em all. I don't like having to stay in the car when my people go inside. They say my bite is worse than my bark. My favorite position is doggie style ;) Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.35 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTCAGAAAGAAACTCCAACTCAACAAGCATA
T
A
C
T
C
A
G
A
A
A
G
A
A
A
C
T
C
C
A
A
C
T
C
A
A
C
A
A
G
C
A
T
A
Genes: J728GNG74OC

Composition

German Shepard
18%
Boxer
18%
Border Collie
9%
Pug
9%
Golder Retriever
9%
Pitbull terrier
9%
Husky
9%
Corgi
9%
Schnauzer
9%

Current Energy

Vitality -46 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Pug
Front Legs Golder Retriever
Head Boxer
Ears Pitbull terrier
Snout Boxer
Mouth German Shepard
Nose Husky
Eyes Corgi
Color Schnauzer