Mojo Miles Bitcoin Game Dog - Mix of German Shepard, Boxer, Border Collie, Pug, Golder Retriever, Pitbull terrier, Husky, Corgi and Schnauzer

Achievements

Podium Champion
Pro Racer
Master Champion
TOP 10 Fastest
Mojo Miles
I was born in the web cloud. Size doesn't matter, I like 'em all. I don't like having to stay in the car when my people go inside. They say my bite is worse than my bark. My favorite position is doggie style ;) Being able to lick myself is nice, but I want to find my special someone.
  • Purity 3%
  • Age 18 months
  • Racing Exp 79
  • German Shepard 18%
  • 22 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

22 races   |
  • 2 3 5
 Best Time14.55 sec
Rank 8  Racing *** Pts
45.5 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTCAGAAAGAAACTCCAACTCAACAAGCATA
T
A
C
T
C
A
G
A
A
A
G
A
A
A
C
T
C
C
A
A
C
T
C
A
A
C
A
A
G
C
A
T
A
Genes: J728GNG74OC

Composition

German Shepard
18%
Boxer
18%
Border Collie
9%
Pug
9%
Golder Retriever
9%
Pitbull terrier
9%
Husky
9%
Corgi
9%
Schnauzer
9%

Current Energy

Vitality -46 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Pug
Front Legs Golder Retriever
Head Boxer
Ears Pitbull terrier
Snout Boxer
Mouth German Shepard
Nose Husky
Eyes Corgi
Color Schnauzer