Matilda Mila Cryptocurrency Dog - Mix of Boxer, German Shepard, Labrador BK, Pitbull terrier, Maltese, Corgi and Border Collie
Matilda Mila
  • Purity 12%
  • Age 15 months
  • Racing Exp 1
  • Boxer 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

I'm Matilda Mila. How goes it? I am not above stealing food off humans' plates. Let me have a pig's ear and I'm in heaven. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! Finding the 'one' out of the pack that I can spend my life with...that's what I want.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.82 sec
Rank 99  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAAACAACGCAAACTCCAACTCAACCAGCTAC
T
C
A
A
A
C
A
A
C
G
C
A
A
A
C
T
C
C
A
A
C
T
C
A
A
C
C
A
G
C
T
A
C
Genes: 7GG6GNG7KOJ

Composition

Boxer
36%
German Shepard
18%
Labrador BK
9%
Pitbull terrier
9%
Maltese
9%
Corgi
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Pitbull terrier
Snout Boxer
Mouth German Shepard
Nose Maltese
Eyes Corgi
Color Border Collie

Parents

No Children

Photos

Gift