Matilda Mila Cryptocurrency Dog - Mix of Boxer, German Shepard, Labrador BK, Pitbull terrier, Maltese, Corgi and Border Collie

Achievements

Racer
Matilda Mila
I'm Matilda Mila. How goes it? I am not above stealing food off humans' plates. Let me have a pig's ear and I'm in heaven. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 12%
  • Age 22 months
  • Racing Exp 2
  • Boxer 36%
  • 2 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time15.82 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAACAACGCAAACTCCAACTCAACCAGCTAC
T
C
A
A
A
C
A
A
C
G
C
A
A
A
C
T
C
C
A
A
C
T
C
A
A
C
C
A
G
C
T
A
C
Genes: 7GG6GNG7KOJ

Composition

Boxer
36%
German Shepard
18%
Labrador BK
9%
Pitbull terrier
9%
Maltese
9%
Corgi
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Pitbull terrier
Snout Boxer
Mouth German Shepard
Nose Maltese
Eyes Corgi
Color Border Collie