Charles Clancy Digital Cryptocurrency Dog - Mix of Boxer, Rottweiler, German Shepard, Labrador BK, Yorkshire Terrier, Maltese, Poodle and Border Collie

Achievements

Racer
Charles Clancy
I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I think hamsters and cats are both over-rated. I hate hiding under the bed during a thunder storm but that's just smart, right?
  • Purity 9%
  • Age 21 months
  • Racing Exp 2
  • Boxer 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time17.33 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAACAACGCAAACCACCACTTAACCGACTAC
T
C
A
A
A
C
A
A
C
G
C
A
A
A
C
C
A
C
C
A
C
T
T
A
A
C
C
G
A
C
T
A
C
Genes: 7GG6GHHFKIJ

Composition

Boxer
27%
Rottweiler
18%
German Shepard
9%
Labrador BK
9%
Yorkshire Terrier
9%
Maltese
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Rottweiler
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Maltese
Eyes Poodle
Color Border Collie