Charles Clancy Digital Cryptocurrency Dog - Mix of Boxer, Rottweiler, German Shepard, Labrador BK, Yorkshire Terrier, Maltese, Poodle and Border Collie
Charles Clancy
  • Purity 9%
  • Age 16 months
  • Racing Exp 1
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I think hamsters and cats are both over-rated. I hate hiding under the bed during a thunder storm but that's just smart, right?

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.33 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAAACAACGCAAACCACCACTTAACCGACTAC
T
C
A
A
A
C
A
A
C
G
C
A
A
A
C
C
A
C
C
A
C
T
T
A
A
C
C
G
A
C
T
A
C
Genes: 7GG6GHHFKIJ

Composition

Boxer
27%
Rottweiler
18%
German Shepard
9%
Labrador BK
9%
Yorkshire Terrier
9%
Maltese
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -21 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Rottweiler
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Maltese
Eyes Poodle
Color Border Collie