Yukon Yoda Litecoin Dog - Mix of German Shepard, Husky and Golder Retriever

Achievements

Racer
Yukon Yoda
Hello, I'm Yukon Yoda. How's it goin'? I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm into group dog piles, the more the better. I like never worrying about my dog poo. I've got people for that.
  • Purity 65%
  • Age 40 months
  • Racing Exp 27
  • German Shepard 82%
  • 6 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 0 0
6 races    Best Time14.12 sec
No rank  Racing *** Coins
50.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCAACATCATCATCATCATCATCAAGATCA
T
C
A
T
C
A
A
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
G
A
T
C
A
Genes: 77477777787

Composition

German Shepard
82%
Husky
9%
Golder Retriever
9%

Current Energy

Vitality -3 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Husky
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Golder Retriever
Color German Shepard