Pinky Phillop Bitcoin Game Dog - Mix of Corgi, Poodle, German Shepard, Husky, Schnauzer, Boxer, Golder Retriever and Labrador BK

Achievements

Racer
Pinky Phillop
I run exclusively on code. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! My bark alone scares birds out of my yard. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 8%
  • Age 40 months
  • Racing Exp 22
  • Corgi 27%
  • 7 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 3
7 races    Best Time14.93 sec
No rank  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCTCAACAATAGACGACAGCAACAGCAGAGCA
A
G
C
T
C
A
A
C
A
A
T
A
G
A
C
G
A
C
A
G
C
A
A
C
A
G
C
A
G
A
G
C
A
Genes: O74CIIOGO86

Composition

Corgi
27%
Poodle
18%
German Shepard
9%
Husky
9%
Schnauzer
9%
Boxer
9%
Golder Retriever
9%
Labrador BK
9%

Current Energy

Vitality -45 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail German Shepard
Legs Husky
Front Legs Schnauzer
Head Poodle
Ears Poodle
Snout Corgi
Mouth Boxer
Nose Corgi
Eyes Golder Retriever
Color Labrador BK