Capone Chica Crypto Dog - Mix of Poodle, Corgi, Labrador BK, Rottweiler, Husky, Border Collie, Beagle, Schnauzer and Boxer

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion
Capone Chica
I'm Capone Chica and I'd like to show you a trick or two. I live in cyberspace. I hate it when my humans fool me with a pill in peanut butter! I never met a crotch or a butt I didn't like, but I'm just friendly that way. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 5%
  • Age 42 months
  • Racing Exp 256
  • Poodle 18%
  • 62 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

62 races   |
  • 8 13 12
 Best Time13.78 sec
No rank  Racing *** Coins
53.2 % wins (33) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACATACGACGACAGCCTAAGCATAAAC
G
C
A
C
A
C
A
C
A
T
A
C
G
A
C
G
A
C
A
G
C
C
T
A
A
G
C
A
T
A
A
A
C
Genes: 6H4JIIODOCG

Composition

Poodle
18%
Corgi
18%
Labrador BK
9%
Rottweiler
9%
Husky
9%
Border Collie
9%
Beagle
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -16 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Border Collie
Head Poodle
Ears Poodle
Snout Corgi
Mouth Beagle
Nose Corgi
Eyes Schnauzer
Color Boxer