Buddie Buffy Virtual Crypto Game Dog - Mix of Rottweiler, Labrador BK, Pug, Border Collie, Shiba Inu, Grey Wolf, Beagle, Yorkshire Terrier, Schnauzer and Boxer

Achievements

Racer
Buddie Buffy
Wassup? Yo, call me Buddie Buffy. I like nibbling on most everything, but I'll bite if you want me to. My female human wears crotchless undies, but she doesn't like the ones I make for her! Getting out of a long relationship, not looking for another
  • Purity 1%
  • Age 41 months
  • Racing Exp 24
  • Rottweiler 18%
  • 5 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 1
5 races    Best Time14.65 sec
No rank  Racing *** Coins
60.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACGAATACCACGTACCCCTATTAATAAAC
G
C
A
C
A
C
G
A
A
T
A
C
C
A
C
G
T
A
C
C
C
C
T
A
T
T
A
A
T
A
A
A
C
Genes: 6H2JHELDFCG

Composition

Rottweiler
18%
Labrador BK
9%
Pug
9%
Border Collie
9%
Shiba Inu
9%
Grey Wolf
9%
Beagle
9%
Yorkshire Terrier
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -24 points
Lunar Effect +10 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Pug
Front Legs Border Collie
Head Rottweiler
Ears Shiba Inu
Snout Grey Wolf
Mouth Beagle
Nose Yorkshire Terrier
Eyes Schnauzer
Color Boxer