Stewie Sarge Cryptocurrency Dog - Mix of Rottweiler, Schnauzer, Grey Wolf, Beagle and Maltese

Achievements

Racer
Stewie Sarge
How's it going? I'm Stewie Sarge. I live inside of a Virtual machine two steps to the right from the firewall. I hate it when my humans fool me with a pill in peanut butter! Slipping my collar, running off and making my humans worried? Every chance I get. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 23%
  • Age 41 months
  • Racing Exp 1
  • Rottweiler 45%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.12 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACATACACCCCCCCCTACACATAACC
C
A
C
C
A
C
C
A
C
A
T
A
C
A
C
C
C
C
C
C
C
C
T
A
C
A
C
A
T
A
A
C
C
Genes: HHHCHLLDHCK

Composition

Rottweiler
45%
Schnauzer
18%
Grey Wolf
18%
Beagle
9%
Maltese
9%

Current Energy

Vitality -44 points
Lunar Effect +18 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Schnauzer
Head Rottweiler
Ears Grey Wolf
Snout Grey Wolf
Mouth Beagle
Nose Rottweiler
Eyes Schnauzer
Color Maltese