Solomon Schotzie Litecoin Dog - Mix of Rottweiler, Beagle, Schnauzer and Maltese
Solomon Schotzie
  • Purity 52%
  • Age 33 months
  • Racing Exp 2
  • Rottweiler 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Hey, Baby. I'm Solomon Schotzie. I really enjoy heavy petting. I hate it when my humans fool me with a pill in peanut butter! Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I adore sleeping upside down with my tongue hanging out!

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time15.85 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCACCACCACCACCACCACCTACACATAACC
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
T
A
C
A
C
A
T
A
A
C
C
Genes: HHHHHHHDHCK

Composition

Rottweiler
73%
Beagle
9%
Schnauzer
9%
Maltese
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Beagle
Nose Rottweiler
Eyes Schnauzer
Color Maltese