Darth Vader Doonesbury Bitcoin Dog - Mix of Rottweiler, Husky, Beagle, French Bulldog and Shiba Inu
Darth Vader Doonesbury
  • Purity 38%
  • Age 16 months
  • Racing Exp 21
  • Rottweiler 64%
  • Gold medal 0 Silver medal 1 Bronze medal 2
  • 5 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Yo dog! Darth Vader Doonesbury here. The Ethernet where I live, rocks. I don't like going to the groomer. Leave my beautiful fur alone! I really enjoy heavy petting. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 5 races
  • 0 1 2
 Best Time14.93 sec
Rank 34  RacingĀ *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCACACACACCACCACCACCTACACCGAGTA
C
A
C
C
A
C
A
C
A
C
A
C
C
A
C
C
A
C
C
A
C
C
T
A
C
A
C
C
G
A
G
T
A
Genes: HH4HHHHDH9E

Composition

Rottweiler
64%
Husky
9%
Beagle
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -18 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Husky
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Beagle
Nose Rottweiler
Eyes French Bulldog
Color Shiba Inu

Parents

No Children

Photos

cryptocurrency dog racing podium Litecoin dog race results online dog race podium
Gift