Darth Vader Doonesbury Bitcoin Dog - Mix of Rottweiler, Husky, Beagle, French Bulldog and Shiba Inu

Achievements

Podium Champion
Pro Racer
Darth Vader Doonesbury
Yo dog! Darth Vader Doonesbury here. The Ethernet where I live, rocks. I don't like going to the groomer. Leave my beautiful fur alone! I really enjoy heavy petting. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 38%
  • Age 18 months
  • Racing Exp 63
  • Rottweiler 64%
  • 17 races
  • Gen 4
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 2 2 4
 Best Time14.93 sec
No rank  Racing *** Pts
47.1 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCACACACACCACCACCACCTACACCGAGTA
C
A
C
C
A
C
A
C
A
C
A
C
C
A
C
C
A
C
C
A
C
C
T
A
C
A
C
C
G
A
G
T
A
Genes: HH4HHHHDH9E

Composition

Rottweiler
64%
Husky
9%
Beagle
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Husky
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Beagle
Nose Rottweiler
Eyes French Bulldog
Color Shiba Inu