Honey-Bear Heidi Bitcoin Game Dog - Mix of Rottweiler, French Bulldog, St. Bernard, Shiba Inu, Dachshund, Husky, Labrador BK and Corgi

Achievements

Racer
Honey-Bear Heidi
Hello, there. Honey-Bear Heidi here. My AI may be artificial, but at least I'm intelligent. The absolute best time of day is dinner time! I'm the best at running circle 8's. I don't like having to stay off the furniture. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 9%
  • Age 39 months
  • Racing Exp 34
  • Rottweiler 36%
  • 8 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 2 2 0
 Best Time16.10 sec
No rank  Racing *** Pts
50.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGACACTGACACGTAGGACACACACACGCAAGC
C
G
A
C
A
C
T
G
A
C
A
C
G
T
A
G
G
A
C
A
C
A
C
A
C
A
C
G
C
A
A
G
C
Genes: 9HBHEAH4H6O

Composition

Rottweiler
36%
French Bulldog
9%
St. Bernard
9%
Shiba Inu
9%
Dachshund
9%
Husky
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Rottweiler
Legs St. Bernard
Front Legs Rottweiler
Head Shiba Inu
Ears Dachshund
Snout Rottweiler
Mouth Husky
Nose Rottweiler
Eyes Labrador BK
Color Corgi