Loretta Lark Bitcoin Dog - Mix of German Shepard, St. Bernard, Border Collie, Beagle, Labrador and Boxer

Achievements

Racer
Loretta Lark
What's up? I'm Loretta Lark. I'm having some new data architecture built for me, then I'd like to have you over to my place. I hate never catching that damn rabbit in my dreams. I like big butts, I cannot lie. I'm not looking to hook up forever, just to have a little fun.
  • Purity 13%
  • Age 40 months
  • Racing Exp 11
  • German Shepard 36%
  • 5 races
  • Gen 6
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
5 races    Best Time15.48 sec
No rank  Racing *** Coins
20.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATGATCATACTGATCATGACTACCATCAAAC
T
C
A
T
G
A
T
C
A
T
A
C
T
G
A
T
C
A
T
G
A
C
T
A
C
C
A
T
C
A
A
A
C
Genes: 7B7JB7BD57G

Composition

German Shepard
36%
St. Bernard
27%
Border Collie
9%
Beagle
9%
Labrador
9%
Boxer
9%

Current Energy

Vitality -19 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Border Collie
Head St. Bernard
Ears German Shepard
Snout St. Bernard
Mouth Beagle
Nose Labrador
Eyes German Shepard
Color Boxer

Parents

No Children

Photos

online doggy race photo