Jalopy Joe Bitcoin Game Dog - Mix of German Shepard, St. Bernard, Border Collie, Shiba Inu and Labrador
Jalopy Joe
  • Purity 17%
  • Age 33 months
  • Racing Exp 252
  • German Shepard 36%
  • Gold medal 13 Silver medal 9 Bronze medal 7
  • 72 races
  • Gen 5
Depressed & Snaillike

Achievements

Podium Champion
Master Champion
Speed Champion
Pro Racer

Bio

How do you do? I'm Jalopy Joe. Even living on the internet like I do, too much kibble makes my bandwidth expand. I don't like having to stay in the car when my people go inside. Spiked dog collars really turn me on. I am a proud show dog. I like showing off my perfect coat!

Racing Stats

Ran 72 races
  • 13 9 7
 Best Time13.77 sec
No rank  RacingĀ *** Pts
40.3 % wins (29) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCATGATCATACTGATCATGAGTACCATCATGA
T
C
A
T
G
A
T
C
A
T
A
C
T
G
A
T
C
A
T
G
A
G
T
A
C
C
A
T
C
A
T
G
A
Genes: 7B7JB7BE57B

Composition

German Shepard
36%
St. Bernard
36%
Border Collie
9%
Shiba Inu
9%
Labrador
9%

Current Energy

Vitality -19 points
Lunar Effect +10 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Border Collie
Head St. Bernard
Ears German Shepard
Snout St. Bernard
Mouth Shiba Inu
Nose Labrador
Eyes German Shepard
Color St. Bernard