Kain Kermit Bitcoin Dog - Mix of Corgi, Shiba Inu, German Shepard, Dachshund, Yorkshire Terrier and Border Collie

Achievements

Racer
Kain Kermit
My AI may be artificial, but at least I'm intelligent. Let me have a pig's ear and I'm in heaven. I've been looking for love in all the wrong places... I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 9%
  • Age 40 months
  • Racing Exp 10
  • Corgi 27%
  • 4 races
  • Gen 6
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
4 races    Best Time14.85 sec
No rank  Racing *** Coins
25.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATTATCATACAGCTCAAGCGTAGGAAGCGGA
G
T
A
T
T
A
T
C
A
T
A
C
A
G
C
T
C
A
A
G
C
G
T
A
G
G
A
A
G
C
G
G
A
Genes: EF7JO7OEAOA

Composition

Corgi
27%
Shiba Inu
18%
German Shepard
18%
Dachshund
18%
Yorkshire Terrier
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Border Collie
Head Corgi
Ears German Shepard
Snout Corgi
Mouth Shiba Inu
Nose Dachshund
Eyes Corgi
Color Dachshund